... ER32 and ER45 (defined by their outer diameter in millimetres). They have the advantage of each covering an 'extended range' (typically 1mm above 3mm nominal size). Used with a matching collet chuck, they were designed originally for ...
... ER32 (GenBank AF051428), and ER32 splice variant lacking exon 5 (GenBank AF124790): ATGATGATGTCCCTGACCAAG; and reverse primers specific for: ER31 3'GCCCTCTTTGCTTTTACTGTC, and the ER32 and ERB2 splice variant: 3°CTTTAGGCCACCGAGTTGGATT ...
... [ Er32 | Y21 ] showing the development of a linear spin density wave with principal moment component along the c - axis . At lower temperatures the ordering " squares - up " as indicated by the appearance of higher - order harmonics ...
... ER 32 / 17-2 " Magnet- geschiebe " . [ Final report of the research project " Magnetic Tracer Technique " funded by the German Research Council , project number ER 32 / 17-2 ] , 54pp . Ergenzinger , P. and J. Conrady , 1982. A new ...
... ER 32 / 17-2 " Magnet- geschiebe " . [ Final report of the research project " Magnetic Tracer Technique " funded by the German Research Council , project number ER 32 / 17-2 ] , 54pp . Ergenzinger , P. and J. Conrady , 1982. A new ...
... (ER 32-33). When asked to describe Mr. Josephy, the informant told the 911 operator that Mr. Josephy was a Native American with black hair in his mid-to late twenties and that he was driving a blue Chevy Blazer (ER 32). When asked about ...