... ER32 collet HP collet 300- 250- 200 150 100- 50 0 6 8 10 12 14 16 Clamping diameter ( mm ) 18 20 22 FIGURE 5.78 Transmitted torque by hydraulic ( h6 tolerance ) , shrink - fit ( h6 tolerance ) , standard collet ( h6 - h11 tolerance ) ...
... ER32 and ER45 (defined by their outer diameter in millimetres). They have the advantage of each covering an 'extended range' (typically 1mm above 3mm nominal size). Used with a matching collet chuck, they were designed originally for ...
... ER32 (GenBank AF051428), and ER32 splice variant lacking exon 5 (GenBank AF124790): ATGATGATGTCCCTGACCAAG; and reverse primers specific for: ER31 3'GCCCTCTTTGCTTTTACTGTC, and the ER32 and ERB2 splice variant: 3°CTTTAGGCCACCGAGTTGGATT ...
... ER32 ER32 NU19-08 NQ23-08 NQ25-01 NQ25-01 ISL 67 ° 48'N 32 ° 17'W GLO2 ER32 NQ25-01 PPL CHNM FJD 69 ° 07'N 65 ° 55'N 67 ° 16'N 51 ° 05'W 36 ° 13'W 53 ° 10'W GLO3 GLO2 GLO3 DB96 XU21 DVO6 NR21-09 NQ23-12 NQ21-03 Nordre Huse Nordre ...
... ER32 NQ25-01 ER32 NQ25-01 Nordre Aputitêq : see Nordre Aputiteeq ISL 67 ° 48'N 32 ° 17'W GL02 ER32 NQ25-01 Nordre Huse Nordre Ikerasaq Nordre Isortoq PPL 69 ° 07'N CHNM 65 ° 55'N FJD 67 ° 16'N 51 ° 05'W GL03 DB96 36 ° 13'W GL02 53 ° 10 ...
... [ Er32 | Y21 ] showing the development of a linear spin density wave with principal moment component along the c - axis . At lower temperatures the ordering " squares - up " as indicated by the appearance of higher - order harmonics ...
... ER32 15.5 960427 = 1981 EX32 15.5 960427 = 1981 EF33 17.5 960427 □ 1981 EH33 14.5 1981 EJ33 17.0 1981 EN33 17.5 1 1981 EO33 15.5 ! 1981 ER33 16.5 1 1981 EV 33 16.5 ! 1981 EX33 15.0 # 1981 EA34 15.0 1981 EE34 17.5 $ 1981 EH34 $ 1981 ...
... ER 32 / 17-2 " Magnet- geschiebe " . [ Final report of the research project " Magnetic Tracer Technique " funded by the German Research Council , project number ER 32 / 17-2 ] , 54pp . Ergenzinger , P. and J. Conrady , 1982. A new ...
... ER 32 / 17-2 " Magnet- geschiebe " . [ Final report of the research project " Magnetic Tracer Technique " funded by the German Research Council , project number ER 32 / 17-2 ] , 54pp . Ergenzinger , P. and J. Conrady , 1982. A new ...